il1b

Ensembl ID:
ENSDARG00000005419
ZFIN ID:
ZDB-GENE-040702-2
Description:
interleukin 1, beta [Source:RefSeq peptide;Acc:NP_998009]
Human Orthologue:
IL1B
Human Description:
interleukin 1, beta [Source:HGNC Symbol;Acc:5992]
Mouse Orthologue:
Il1b
Mouse Description:
interleukin 1 beta Gene [Source:MGI Symbol;Acc:MGI:96543]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16617 Essential Splice Site Available for shipment Available now
sa31807 Nonsense Mutation detected in F1 DNA During 2016
sa21819 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16617
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015991 Essential Splice Site None 272 1 7
Genomic Location (Zv9):
Chromosome 10 (position 46400973)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45110103
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAACACACACTTTCACATGAGAAAGCAGAGGAACTTAACCAGCTCWGG[T/A]ATGTGGAGTGCAGATTACATGCATTTTACTAYTAYTATTATTATCAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31807
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015991 Nonsense 23 272 3 7
Genomic Location (Zv9):
Chromosome 10 (position 46400724)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45110352
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTAAAAAGCTGATATTTTGCAGTTTGTGGGAGACAGACAGTGCTGTTTA[T/A]TCAGATTCTGATGAGATGGACTGTTCAGATCCGCTTGCAATGGTGAGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21819
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015991 Essential Splice Site 150 272 5 7
Genomic Location (Zv9):
Chromosome 10 (position 46397418)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 45113658
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCACATTTGCAGGCCGTCACACTGAGAGCCGGAAGCAGCGACTTGAAAG[G/A]TAAGCATCAGCATTTACACACCTGTGGGTTTATTTTACTGTAGAATTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link