map3k5

Ensembl ID:
ENSDARG00000005416
ZFIN ID:
ZDB-GENE-030827-3
Description:
mitogen-activated protein kinase kinase kinase 5 [Source:RefSeq peptide;Acc:NP_001155222]
Human Orthologue:
MAP3K5
Human Description:
mitogen-activated protein kinase kinase kinase 5 [Source:HGNC Symbol;Acc:6857]
Mouse Orthologue:
Map3k5
Mouse Description:
mitogen-activated protein kinase kinase kinase 5 Gene [Source:MGI Symbol;Acc:MGI:1346876]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32269 Nonsense Mutation detected in F1 DNA During 2016
sa32268 Essential Splice Site Mutation detected in F1 DNA During 2016
sa43368 Nonsense Mutation detected in F1 DNA During 2016
sa17844 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32269
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046641 Nonsense 684 1364 15 30
Genomic Location (Zv9):
Chromosome 20 (position 3067910)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3021772
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCATGGAGAGAAGGTGGTTCTGGGTAAGGGCACCTTTGGAGTTGTCTA[C/A]GCTGGCCGTGACCTCAGTAACCAGGTGCGCTTAGCCATCAAAGAGATACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32268
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046641 Essential Splice Site 1163 1364 25 30
Genomic Location (Zv9):
Chromosome 20 (position 3049589)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3003451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACATCATTCGAAAGGCTGTGCAGACTGCCATCGTCATATTGGTACCTG[G/A]TAAATGAAACCTTTATTTCTAAAACAATCTGGTAACTGCACATTCATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43368
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046641 Nonsense 1229 1364 26 30
Genomic Location (Zv9):
Chromosome 20 (position 3048635)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3002497
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAGTGAGCACGCTTAGTTCAACAGTTTCCCACGAGTCGCAGAGCGCG[C/T]AGAGGTCTATCAGCATGGAGCTGGGTCGCATGAAGCTAGAAACCAAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17844
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046641 Nonsense 1247 1364 27 30
Genomic Location (Zv9):
Chromosome 20 (position 3047171)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3001033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYATTTCGTCTGCTGTTTACATATGRCTGTGCTTRTRTGTTCTAGGTTGT[T/A]GGAGGAATTAGTAGARAAGGAGCGAGAATATCAGGCCATCCTGCAGCAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link