map3k5

Ensembl ID:
ENSDARG00000005416
ZFIN ID:
ZDB-GENE-030827-3
Description:
mitogen-activated protein kinase kinase kinase 5 [Source:RefSeq peptide;Acc:NP_001155222]
Human Orthologue:
MAP3K5
Human Description:
mitogen-activated protein kinase kinase kinase 5 [Source:HGNC Symbol;Acc:6857]
Mouse Orthologue:
Map3k5
Mouse Description:
mitogen-activated protein kinase kinase kinase 5 Gene [Source:MGI Symbol;Acc:MGI:1346876]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7925 Nonsense Mutation detected in F1 DNA During 2014
sa17844 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7925
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046641 Nonsense 935 1364 20 30
Genomic Location:
Chromosome 20 (position 3057288)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAACGATCTGCTCACCCATGAGTTCCTCACCGTCACATCMCGCAAAAAA[C/T]GATCCAAGACCAGCAGTTTCACAGGTGCGCTTTGTGTTAAAGTTCCCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17844
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046641 Nonsense 1247 1364 27 30
Genomic Location:
Chromosome 20 (position 3047171)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYATTTCGTCTGCTGTTTACATATGRCTGTGCTTRTRTGTTCTAGGTTGT[T/A]GGAGGAATTAGTAGARAAGGAGCGAGAATATCAGGCCATCCTGCAGCAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/441759a8