trim3b

Ensembl ID:
ENSDARG00000005397
ZFIN ID:
ZDB-GENE-070112-1132
Description:
tripartite motif-containing 3b [Source:RefSeq peptide;Acc:NP_001073637]
Human Orthologue:
TRIM3
Human Description:
tripartite motif-containing 3 [Source:HGNC Symbol;Acc:10064]
Mouse Orthologue:
Trim3
Mouse Description:
tripartite motif-containing 3 Gene [Source:MGI Symbol;Acc:MGI:1860040]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6173 Essential Splice Site Mutation detected in F1 DNA During 2014
sa15924 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6173
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008134 Essential Splice Site 45 748 2 12
ENSDART00000109183 Essential Splice Site 49 772 1 12
ENSDART00000136472 Essential Splice Site 49 752 2 12

The following transcripts of ENSDARG00000005397 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 26790145)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTACCACAATCCCAAAGTCCTGCCCTGCCTGCACACCTTCTGCGAAAG[G/T]TCTGTATCTGTTGCCACTTTGATTGATAATTAAARAGGGAAKGAGGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15924
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008134 Nonsense 263 748 6 12
ENSDART00000109183 Nonsense 267 772 5 12
ENSDART00000136472 Nonsense 267 752 6 12

The following transcripts of ENSDARG00000005397 do not overlap with this mutation:

Genomic Location:
Chromosome 10 (position 26778734)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGGGAAARGAGCACATCCAGAGCAGCTGCAGTTTCACCGAACAGGCAT[T/A]GAGCCACGGCAGCGCTACTGAAGTCCTGCTGGTYCAGAAGCAGATGAGYG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5m6g2nk9