dnmt8

Ensembl ID:
ENSDARG00000005394
ZFIN ID:
ZDB-GENE-050314-5
Description:
DNA (cytosine-5-)-methyltransferase 8 [Source:RefSeq peptide;Acc:NP_001018144]
Human Orthologues:
DNMT3A, DNMT3L
Human Descriptions:
DNA (cytosine-5-)-methyltransferase 3 alpha [Source:HGNC Symbol;Acc:2978]
DNA (cytosine-5-)-methyltransferase 3-like [Source:HGNC Symbol;Acc:2980]
Mouse Orthologues:
Dnmt3a, Dnmt3l
Mouse Descriptions:
DNA (cytosine-5-)-methyltransferase 3-like Gene [Source:MGI Symbol;Acc:MGI:1859287]
DNA methyltransferase 3A Gene [Source:MGI Symbol;Acc:MGI:1261827]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31049 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43531 Essential Splice Site Mutation detected in F1 DNA During 2017
sa617 Nonsense Available for shipment Available now
sa37156 Nonsense Mutation detected in F1 DNA During 2017
sa8988 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31049
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031712 Essential Splice Site 370 997 7 23
ENSDART00000100320 Essential Splice Site 225 852 4 20
ENSDART00000031712 Essential Splice Site 370 997 7 23
ENSDART00000100320 Essential Splice Site 225 852 4 20
Genomic Location (Zv9):
Chromosome 20 (position 47274102)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 47095874
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGTGAGAAAGTTCTGACAGGAATCGCGCCGATACACCAAGAGTACCAG[G/A]TGAATATCTTAAAAATCTCTCCCTTCAGATATTTTTTGTGGCCTAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43531
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031712 Essential Splice Site 370 997 7 23
ENSDART00000100320 Essential Splice Site 225 852 4 20
ENSDART00000031712 Essential Splice Site 370 997 7 23
ENSDART00000100320 Essential Splice Site 225 852 4 20
Genomic Location (Zv9):
Chromosome 20 (position 47274102)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 47095874
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGTGAGAAAGTTCTGACAGGAATCGCGCCGATACACCAAGAGTACCAG[G/A]TGAATATCTTAAAAATCTCTCCCTTCAGATATTTTTTGTGGCCTAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa617
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031712 Nonsense 811 997 18 23
ENSDART00000100320 Nonsense 666 852 15 20
Genomic Location (Zv9):
Chromosome 20 (position 47249374)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 47071146
KASP Assay ID:
554-0527.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCCTGTAATGATCTGTCCATCGTCAACCCTGCTAGGAAAGGCTTGTTT[G/T]GTATGACACACGCCATTAGATCCATTTTCCTCACTAAAATCATAAGATTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa37156
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031712 Nonsense 826 997 19 23
ENSDART00000100320 Nonsense 681 852 16 20
Genomic Location (Zv9):
Chromosome 20 (position 47249230)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 47071002
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGCAGAGGGAACCGGGCGCCTGTTCTTTGAGTTTTACCGGCTGCTTCAC[G/T]AAGCGCGGCCTAAAGAAGGAGACGACCGCCCGTTTTTCTGGCTGTTCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8988
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000031712 Essential Splice Site 889 997 20 23
ENSDART00000100320 Essential Splice Site 744 852 17 20
Genomic Location (Zv9):
Chromosome 20 (position 47245196)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 47066968
KASP Assay ID:
2261-4918.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCGCACACAGAGCTCGATACTTCTGGGGGAACCTTCCTGGGATGAATCG[G/A]TAAGACTGCTTGTGTCTGAGAGTRGCTGCTATTTTACTAGCGTTCGAAAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)
  • Type 1 diabetes: A genome-wide meta-analysis of six type 1 diabetes cohorts identifies multiple associated loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link