prdm9

Ensembl ID:
ENSDARG00000005382
ZFIN ID:
ZDB-GENE-040426-1319
Description:
Histone-lysine N-methyltransferase PRDM9 [Source:UniProtKB/Swiss-Prot;Acc:Q6P2A1]
Human Orthologue:
PRDM7
Human Description:
PR domain containing 7 [Source:HGNC Symbol;Acc:9351]
Mouse Orthologue:
Prdm9
Mouse Description:
PR domain containing 9 Gene [Source:MGI Symbol;Acc:MGI:2384854]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1923 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa1923
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027321 Nonsense 354 853 6 6
ENSDART00000126858 Nonsense 311 598 6 8
ENSDART00000129894 Nonsense 311 629 6 9
Genomic Location (Zv9):
Chromosome 12 (position 10757984)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 9745406
KASP Assay ID:
554-1912.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCATGTGTTGATTGCGGTCGGTCGTTTTTGAGATCTTGTCATCTGAAG[C/T]GACATCAGCGCACCATTCACTCCAAAGAGAAGCCTTATTGCTGCAGCCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link