NP_001128602.1

Ensembl ID:
ENSDARG00000005374
Description:
gamma-tubulin complex component 4 [Source:RefSeq peptide;Acc:NP_001128602]
Human Orthologue:
TUBGCP4
Human Description:
tubulin, gamma complex associated protein 4 [Source:HGNC Symbol;Acc:16691]
Mouse Orthologue:
Tubgcp4
Mouse Description:
tubulin, gamma complex associated protein 4 Gene [Source:MGI Symbol;Acc:MGI:1196293]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8846 Nonsense Mutation detected in F1 DNA During 2017
sa21080 Nonsense Available for shipment Available now
sa41027 Essential Splice Site Mutation detected in F1 DNA During 2017
sa2377 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa8846
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009649 Nonsense 199 668 7 18
Genomic Location (Zv9):
Chromosome 7 (position 54403124)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52673115
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATGTATAAGCAGCTGGCGGCGTGGATGCTGCACGGGCTGCTGCYAGAC[C/T]AGAGCGAGGAGTTTTTCGTCAAGCAGGGCCCCAGTGCTGGYGGAGCCACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21080
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009649 Nonsense 355 668 10 18
Genomic Location (Zv9):
Chromosome 7 (position 54400953)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52670944
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCACTTATGGACTTTAATGGTAGAAGAATCTGATCTTTTGGGGCAGCTC[A/T]AGGTAAATAAAAAGTAGTTTTTTGACGATACACTTACTGGTGCAAGTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41027
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009649 Essential Splice Site 427 668 12 18
Genomic Location (Zv9):
Chromosome 7 (position 54396345)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52666336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCCACTCCTCCACCTCACCATAGACTACCATGGAAAAGAAAGCAAAGG[T/C]ATTTCTGACTGACAAGCATTTTCATCTACATATGAAATACACATCATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2377
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009649 Essential Splice Site 618 668 16 18
Genomic Location (Zv9):
Chromosome 7 (position 54394259)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52664250
KASP Assay ID:
554-3182.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGGTCTCTGGATGAGCGAGGAACAGCTCAGCTGGACATTCTTGTGAAG[G/A]TAGGGTTAAATGTATTTTCATTTCATTTTTTTGTAAAACCTGCTTTGGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link