gprc6a

Ensembl ID:
ENSDARG00000005371
ZFIN ID:
ZDB-GENE-041217-22
Description:
G-protein coupled receptor family C group 6 member A [Source:UniProtKB/Swiss-Prot;Acc:Q5U9X3]
Human Orthologue:
GPRC6A
Human Description:
G protein-coupled receptor, family C, group 6, member A [Source:HGNC Symbol;Acc:18510]
Mouse Orthologue:
Gprc6a
Mouse Description:
G protein-coupled receptor, family C, group 6, member A Gene [Source:MGI Symbol;Acc:MGI:2429498]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14430 Nonsense Available for shipment Available now
sa36190 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14430
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008880 Nonsense 386 867 3 6
Genomic Location (Zv9):
Chromosome 16 (position 34470762)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32202262
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAATGCTTCCAATACCGTGCTGGAGCTGATGAWAAGCACCAATTTRGAC[A/T]AGATTTTCAGCATTRAGATGGCCGTYACTGCTGTTGCTAATGCTGTGRCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36190
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008880 Nonsense 543 867 6 6
Genomic Location (Zv9):
Chromosome 16 (position 34472462)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32203962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAATTTCAGATGCTGATGAATGTTCCCCATGTGACAGTGAGAGCATGTG[G/A]TCATTGGCCAACAGCACTGAATGTCATCCCAAGGTTTTTGAATACTTTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • C-reactive protein: Meta-analysis of genome-wide association studies in >80 000 subjects identifies multiple loci for C-reactive protein levels. (View Study)
  • Prostate cancer: Genome-wide association study identifies five new susceptibility loci for prostate cancer in the Japanese population. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link