mcamb

Ensembl ID:
ENSDARG00000005368
ZFIN ID:
ZDB-GENE-030219-213
Description:
melanoma cell adhesion molecule b [Source:RefSeq peptide;Acc:NP_001012367]
Human Orthologue:
MCAM
Human Description:
melanoma cell adhesion molecule [Source:HGNC Symbol;Acc:6934]
Mouse Orthologue:
Mcam
Mouse Description:
melanoma cell adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:1933966]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32033 Nonsense Available for shipment Available now
sa10561 Nonsense Available for shipment Available now
sa16313 Nonsense Available for shipment Available now
sa35880 Nonsense Mutation detected in F1 DNA During 2016
sa39042 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32033
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020425 Nonsense 55 617 2 15
ENSDART00000115362 Nonsense 55 630 2 16
Genomic Location (Zv9):
Chromosome 15 (position 22643353)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23354540
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATCAGCTGTACTTACACTCTGACGGAAGAAGCCAAGATGATAATCTG[G/A]TTTACGGTGAGAAAAAGACATGTTCATAATCTACACTGTTTAATATTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10561
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020425 Nonsense 95 617 3 15
ENSDART00000115362 Nonsense 95 630 3 16
Genomic Location (Zv9):
Chromosome 15 (position 22640492)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23351679
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATYGATCAGAACCATGAATATGCAGAKCGGATCAAAGTCAGTCACTCTTA[T/G]GACACAGAGGAAGAGCRTGGTAGTGTTGTTCTGATCCTCGACGATGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16313
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020425 Nonsense 112 617 3 15
ENSDART00000115362 Nonsense 112 630 3 16
Genomic Location (Zv9):
Chromosome 15 (position 22640443)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23351630
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AKGACACAGAGGAAGAGCRTGGYAGTGTTGTTCTGAWYCTCGACGATGTG[C/T]AACTGACTGATGAGAGAGAGTTCWTMTGCATGGTGCACAGWGTGTTGAAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35880
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020425 Nonsense 218 617 6 15
ENSDART00000115362 Nonsense 218 630 6 16
Genomic Location (Zv9):
Chromosome 15 (position 22639882)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23351069
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACGGTCAAACCAAGTGGCCTGTTCAGGGTAGAGAGTGAACTGCATATC[A/T]AAGTCAAGAAGGAAGATGAAGGTGCTCATTTCTACTGTGAAGTCAAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39042
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020425 Nonsense 521 617 12 15
ENSDART00000115362 Nonsense 521 630 12 16
Genomic Location (Zv9):
Chromosome 15 (position 22634467)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 23345654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGCAGCGCCACCAATGAGCTGGGCACAGATGATGCTTCTCAAAGCATT[A/T]AAGCATGTAAGTGTTTGTTTTCAGACTGGATGAATTCCTCTACTTGAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link