mcamb

Ensembl ID:
ENSDARG00000005368
ZFIN ID:
ZDB-GENE-030219-213
Description:
melanoma cell adhesion molecule b [Source:RefSeq peptide;Acc:NP_001012367]
Human Orthologue:
MCAM
Human Description:
melanoma cell adhesion molecule [Source:HGNC Symbol;Acc:6934]
Mouse Orthologue:
Mcam
Mouse Description:
melanoma cell adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:1933966]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10561 Nonsense Available for shipment Available now
sa16313 Nonsense Available for shipment Available now
sa4604 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10561
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020425 Nonsense 95 617 3 15
ENSDART00000115362 Nonsense 95 630 3 16
Genomic Location:
Chromosome 15 (position 22640492)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATYGATCAGAACCATGAATATGCAGAKCGGATCAAAGTCAGTCACTCTTA[T/G]GACACAGAGGAAGAGCRTGGTAGTGTTGTTCTGATCCTCGACGATGTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16313
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020425 Nonsense 112 617 3 15
ENSDART00000115362 Nonsense 112 630 3 16
Genomic Location:
Chromosome 15 (position 22640443)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AKGACACAGAGGAAGAGCRTGGYAGTGTTGTTCTGAWYCTCGACGATGTG[C/T]AACTGACTGATGAGAGAGAGTTCWTMTGCATGGTGCACAGWGTGTTGAAY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4604
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020425 Essential Splice Site 254 617 6 15
ENSDART00000115362 Essential Splice Site 254 630 6 16
Genomic Location:
Chromosome 15 (position 22639772)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTAAAGCAAGAATGACAGAGTCCAGTCGATTCAACGTCACAGTTCATTG[T/A]GAGTCAGATTGCTTTCAGCCTGCTTCTAATTTAAATAGGCAGTTCACAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0kqv4q1r