grin3b

Ensembl ID:
ENSDARG00000005364
ZFIN ID:
ZDB-GENE-070912-354
Human Orthologue:
GRIN3B
Human Description:
glutamate receptor, ionotropic, N-methyl-D-aspartate 3B [Source:HGNC Symbol;Acc:16768]
Mouse Orthologue:
Grin3b
Mouse Description:
glutamate receptor, ionotropic, NMDA3B Gene [Source:MGI Symbol;Acc:MGI:2150393]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25813 Nonsense Mutation detected in F1 DNA During 2017
sa38334 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25813
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058111 Nonsense 126 1118 1 9
ENSDART00000147354 Nonsense 94 912 1 8
Genomic Location (Zv9):
Chromosome 2 (position 26209185)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26405381
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGAGTCTCGGCTGTGCTCGCGTTCCCCCAGAGCCACGAGGAGCTCATA[C/T]AAGTGGAGTTCATGTCCTCGTTTTTGGAAATACCCTTCATCAGCATCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38334
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000058111 Essential Splice Site 816 1118 5 9
ENSDART00000147354 Essential Splice Site 784 912 5 8
Genomic Location (Zv9):
Chromosome 2 (position 26275296)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 26471492
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGCAGACTGCAAACTCCTGACTGTAGGAAAACCGTTTGCTATTGAAGG[T/G]AAGGTCCGCTGTGCCACTGAAACATATTGCTAACACCTCAGGCTATGCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link