tyro3

Ensembl ID:
ENSDARG00000005356
ZFIN ID:
ZDB-GENE-990714-13
Description:
Tyrosine-protein kinase receptor TYRO3 [Source:UniProtKB/Swiss-Prot;Acc:Q9YI66]
Human Orthologue:
TYRO3
Human Description:
TYRO3 protein tyrosine kinase [Source:HGNC Symbol;Acc:12446]
Mouse Orthologue:
Tyro3
Mouse Description:
TYRO3 protein tyrosine kinase 3 Gene [Source:MGI Symbol;Acc:MGI:104294]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17598 Essential Splice Site, Splice Site Available for shipment Available now
sa5899 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17598
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Essential Splice Site, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040431 Splice Site None 868 None 19
ENSDART00000081659 Splice Site None 691 None 20
ENSDART00000140391 Essential Splice Site 200 868 6 19
Genomic Location:
Chromosome 17 (position 10076282)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAARWACAAATATAATRTTTTTCATTAWATGCGTATTGTTTTTTTNATGTA[C/T]AGCCCGGCCTGATTCMCCTCGGGACGTMCAGGTTCATCATGTKTYGGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5899
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040431 Nonsense 722 868 18 19
ENSDART00000081659 None None 691 19 20
ENSDART00000140391 Nonsense 722 868 18 19
Genomic Location:
Chromosome 17 (position 10049211)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTACCCAGGAGTGGAGAACTCWGAGATCTACGAGTATCTTATCAAGGGA[G/T]AAAGACTAAAGCAGCCGCCGGACTGCCCTSCTGACATGTACGTTTTAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bogrlluz