tyro3

Ensembl ID:
ENSDARG00000005356
ZFIN ID:
ZDB-GENE-990714-13
Description:
Tyrosine-protein kinase receptor TYRO3 [Source:UniProtKB/Swiss-Prot;Acc:Q9YI66]
Human Orthologue:
TYRO3
Human Description:
TYRO3 protein tyrosine kinase [Source:HGNC Symbol;Acc:12446]
Mouse Orthologue:
Tyro3
Mouse Description:
TYRO3 protein tyrosine kinase 3 Gene [Source:MGI Symbol;Acc:MGI:104294]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5899 Nonsense Mutation detected in F1 DNA During 2015
sa28813 Nonsense Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa5899
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040431 Nonsense 722 868 18 19
ENSDART00000081659   None 691 19 20
ENSDART00000140391 Nonsense 722 868 18 19
Genomic Location:
Chromosome 17 (position 10049211)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTACCCAGGAGTGGAGAACTCWGAGATCTACGAGTATCTTATCAAGGGA[G/T]AAAGACTAAAGCAGCCGCCGGACTGCCCTSCTGACATGTACGTTTTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28813
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000040431 Nonsense 766 868 19 19
ENSDART00000081659   None 691 20 20
ENSDART00000140391 Nonsense 766 868 19 19
Genomic Location:
Chromosome 17 (position 10048820)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCCAGTTTCCAGCACCTCATTGACCAATTGGAGCTCCTGTGGGCGAAGT[T/A]GAATCCTGCTCCTGTAAAAGAGCCATTGCTGTATGTCAACCTTGAGGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bogrlluz