dip2ba

Ensembl ID:
ENSDARG00000005350
ZFIN ID:
ZDB-GENE-040426-2305
Description:
Disco-interacting protein 2 homolog B-A [Source:UniProtKB/Swiss-Prot;Acc:Q6NVJ5]
Human Orthologue:
DIP2B
Human Description:
DIP2 disco-interacting protein 2 homolog B (Drosophila) [Source:HGNC Symbol;Acc:29284]
Mouse Orthologue:
Dip2b
Mouse Description:
DIP2 disco-interacting protein 2 homolog B (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2145977]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29943 Nonsense Mutation detected in F1 DNA During 2017
sa37730 Essential Splice Site Available for shipment Available now
sa6740 Nonsense Mutation detected in F1 DNA During 2017
sa37729 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29943
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019521 Nonsense 40 1577 2 38
Genomic Location (Zv9):
Chromosome 23 (position 27636474)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27469296
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTTTGTTCTCGCAGGTGACATCACACAGAAAGGCTATGAAAAGAAG[C/T]GAGCTAAACTGCTGGCTCCATTCGTACCACAGACCCAAAGTAAGACTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37730
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019521 Essential Splice Site 217 1577 5 38
Genomic Location (Zv9):
Chromosome 23 (position 27629764)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27462586
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGGGCAGACCAGTGCGCTCGCAGATGTGCTGGCACACACCCGCATAGG[T/C]ACTGCAGGATCATGAGTCACACAAACACACGTGTTCAAGTGCTGAATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6740
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019521 Nonsense 895 1577 23 38
Genomic Location (Zv9):
Chromosome 23 (position 27618484)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27451306
KASP Assay ID:
554-4793.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TNGACTGTGTTCCTATAGGCTATAGACAGTATCCACCAGGTGGGCTTGTA[T/A]TGTTTGGCGCTGGTGCCTGCAAATACATTACCCAAAACTCCACTGGGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37729
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019521 Nonsense 1406 1577 36 38
Genomic Location (Zv9):
Chromosome 23 (position 27602354)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 27435176
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATTTTCCTCTCAGATCTGGGTGAACAGTCCTCATAACGCCAGTGGTTA[T/G]TATACGATCTATGGTGAGGAGAGCCTGCAGGCAGACCACTTCAACACTCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Colorectal cancer: Meta-analysis of three genome-wide association studies identifies susceptibility loci for colorectal cancer at 1q41, 3q26.2, 12q13.13 and 20q13.33. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link