ccdc85al

Ensembl ID:
ENSDARG00000005343
ZFIN ID:
ZDB-GENE-040912-92
Description:
coiled-coil domain containing 85A, like [Source:RefSeq peptide;Acc:NP_001004570]
Human Orthologue:
CCDC85A
Human Description:
coiled-coil domain containing 85A [Source:HGNC Symbol;Acc:29400]
Mouse Orthologue:
Ccdc85a
Mouse Description:
coiled-coil domain containing 85A Gene [Source:MGI Symbol;Acc:MGI:2445069]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20619 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20619
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106610 Nonsense 106 367 3 6
ENSDART00000141126 Nonsense 106 367 3 6
Genomic Location:
Chromosome 6 (position 6686536)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTAAGAGACCTGTGCTGTTTCCTGGATGATGACCGGCAGAAGGGCAAG[C/T]GAGTGTCTCGTGAGTGGCAGCGTCTGGGTCGTTTCAGCGCCAGCGTCATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/byufnxhq