tln1

Ensembl ID:
ENSDARG00000005333
ZFIN ID:
ZDB-GENE-031002-48
Description:
talin-1 [Source:RefSeq peptide;Acc:NP_001009560]
Human Orthologue:
TLN1
Human Description:
talin 1 [Source:HGNC Symbol;Acc:11845]
Mouse Orthologue:
Tln1
Mouse Description:
talin 1 Gene [Source:MGI Symbol;Acc:MGI:1099832]

Alleles

There are 14 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6161 Nonsense Mutation detected in F1 DNA During 2016
sa34845 Nonsense Mutation detected in F1 DNA During 2016
sa11348 Nonsense Available for shipment Available now
sa34846 Essential Splice Site Mutation detected in F1 DNA During 2016
sa2572 Essential Splice Site F2 line generated During 2016
sa21664 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41593 Essential Splice Site Mutation detected in F1 DNA During 2016
sa5825 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38777 Nonsense Mutation detected in F1 DNA During 2016
sa15487 Nonsense Available for shipment Available now
sa31764 Nonsense Mutation detected in F1 DNA During 2016
sa10075 Nonsense Available for shipment Available now
sa21665 Nonsense Mutation detected in F1 DNA During 2016
sa21666 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6161
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013609 Nonsense 40 2538 2 56
ENSDART00000078135 Nonsense 40 2544 2 56
ENSDART00000098857 Nonsense 40 323 2 10
ENSDART00000098858 Nonsense 40 405 2 12
Genomic Location:
Chromosome 10 (position 8155703)
KASP Assay ID:
554-5227.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTGGYGTACGACGCCTGTCGAATYATCAGGGAGAGAGTTCCAGAAGCA[C/T]AACTCGGCCAGCGTRAGTCCATCAGCAGTATACTCAGAACCCTGTCTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34845
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013609 Nonsense 189 2538 6 56
ENSDART00000078135 Nonsense 189 2544 6 56
ENSDART00000098857 Nonsense 189 323 6 10
ENSDART00000098858 Nonsense 189 405 6 12
Genomic Location:
Chromosome 10 (position 8163970)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGGTTGGATCATGGGCGGACGCTGCGGGAGCAGGGTGTCGAGGAGTCT[G/T]AGATGCTGCTTCTTAGGAGAAAGTTCTTCTACTCAGACCAGAATGTGGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11348
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013609 Nonsense 216 2538 6 56
ENSDART00000078135 Nonsense 216 2544 6 56
ENSDART00000098857 Nonsense 216 323 6 10
ENSDART00000098858 Nonsense 216 405 6 12
Genomic Location:
Chromosome 10 (position 8164053)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGACCAGAATGTGGATTCCAGAGAYCCTGTACAGCTCAACCTGYTGTA[T/A]GTGCAGGTAAWAACCACAGGAAATYCTCTTCGCATCGYAATCATGGCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34846
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013609 Essential Splice Site 261 2538 7 56
ENSDART00000078135 Essential Splice Site 261 2544 7 56
ENSDART00000098857 Essential Splice Site 261 323 7 10
ENSDART00000098858 Essential Splice Site 261 405 7 12
Genomic Location:
Chromosome 10 (position 8165130)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCAGTTTGGAGACCACAATGAGTCCAAACACAAACCTGGATTCCTAGA[G/A]TAAGCACTCACGTTTCTATAATTCGAAAATCCTGCTTTTGTGTGGTGTCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2572
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013609 Essential Splice Site 398 2538 11 56
ENSDART00000078135 Essential Splice Site 402 2544 11 56
ENSDART00000098857   None 323 None 10
ENSDART00000098858 Essential Splice Site 402 405 11 12
ENSDART00000013609 Essential Splice Site 398 2538 11 56
ENSDART00000078135 Essential Splice Site 402 2544 11 56
ENSDART00000098857   None 323 None 10
ENSDART00000098858 Essential Splice Site 402 405 11 12
Genomic Location:
Chromosome 10 (position 8174609)
KASP Assay ID:
554-3431.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGATTGCACAACTCATTGCTGGATACATTGACATCATTCTCAAAAAGG[T/C]AACACGCTATGACTTCTCAGGGGTGTGCAGCATTGACCAGAATGTTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21664
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013609 Essential Splice Site 424 2538 12 56
ENSDART00000078135 Essential Splice Site 428 2544 12 56
ENSDART00000098857   None 323 None 10
ENSDART00000098858   None 405 None 12
Genomic Location:
Chromosome 10 (position 8176680)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGGAGATGAAGAGTCAACCATGTTGGAGGACTCCGTCTCTCCGAAAAAG[T/C]GAGCCCCTTTAATAGTTCATTGCATTCTGGATACACAGAAACAGATATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41593
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013609 Essential Splice Site 558 2538 15 56
ENSDART00000078135 Essential Splice Site 562 2544 15 56
ENSDART00000098857   None 323 None 10
ENSDART00000098858   None 405 None 12
Genomic Location:
Chromosome 10 (position 8182461)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGGATGCCATCACTGCGGGAACTGCTTCCATGGTCAATCTGACTGCAG[G/A]TGAGACGCTCGCAACATCTCACCGTTCACATCTTTGCGGCGGGTGGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5825
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013609 Essential Splice Site 1438 2538 33 56
ENSDART00000078135 Essential Splice Site 1441 2544 33 56
ENSDART00000098857   None 323 None 10
ENSDART00000098858   None 405 None 12
Genomic Location:
Chromosome 10 (position 8240105)
KASP Assay ID:
554-3889.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGTTCAGCGTCTAAAGCGCTGTGTGGTCTCACTGAAGCAGCTGCTCAG[G/A]TAAAAACRCTTATGTGTGTGTGTGTCNNNNTGTGTGAAGCTCATCTCTCCTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38777
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013609 Nonsense 1520 2538 35 56
ENSDART00000078135 Nonsense 1523 2544 35 56
ENSDART00000098857   None 323 None 10
ENSDART00000098858   None 405 None 12
Genomic Location:
Chromosome 10 (position 8243369)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGCCTGCCGGCTCGCCTCCTCCAAGACATCCAACCCAGTTGCTAAGAGA[C/T]AGTTCGTCCAGAGTGCCAAAGAGGTGGCCAACAGCACAGCCAACCTCGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15487
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013609 Nonsense 2108 2538 46 56
ENSDART00000078135 Nonsense 2114 2544 46 56
ENSDART00000098857   None 323 None 10
ENSDART00000098858   None 405 None 12
Genomic Location:
Chromosome 10 (position 8263823)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGCCACCAAAGCAGCGGCCGGCAAACCTCACGATGACCCCGCCATGCTG[C/T]AGCTCAARAACTCTGCTAAGGTACAAAACATTCTCCAACACACAGCCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31764
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013609 Nonsense 2136 2538 47 56
ENSDART00000078135 Nonsense 2142 2544 47 56
ENSDART00000098857   None 323 None 10
ENSDART00000098858   None 405 None 12
Genomic Location:
Chromosome 10 (position 8266596)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGACGTCTCTACTTAAGACGGTGAAGGCGGTGGAGGATGAAGCCACT[A/T]AAGGCACACGAGCACTAGAGGCCACCATAGAGCACATCAAACAAGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10075
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013609 Nonsense 2205 2538 48 56
ENSDART00000078135 Nonsense 2211 2544 48 56
ENSDART00000098857   None 323 None 10
ENSDART00000098858   None 405 None 12
Genomic Location:
Chromosome 10 (position 8267645)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAACTCCTGCCRTCAGGAGGAYGTGATCGCCACWGCTAACCTAAGCAGA[C/T]GAGCTGTCGCAGACATGCTGCGCTCCTGCAAGGTGAGGCCACTTTCAMAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21665
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013609 Nonsense 2306 2538 51 56
ENSDART00000078135 Nonsense 2312 2544 51 56
ENSDART00000098857   None 323 None 10
ENSDART00000098858   None 405 None 12
Genomic Location:
Chromosome 10 (position 8284155)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTGGGTGGATCCCGAAGACCCCACCGTCATTGCAGAAAACGAGCTGCTG[G/T]GAGCCGCAGCTGCCATTGAAGCTGCCGCGAAGAAACTAGAGCAGCTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21666
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013609 Essential Splice Site 2328 2538 51 56
ENSDART00000078135 Essential Splice Site 2334 2544 51 56
ENSDART00000098857   None 323 None 10
ENSDART00000098858   None 405 None 12
Genomic Location:
Chromosome 10 (position 8284225)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGCCGCGAAGAAACTAGAGCAGCTCAAACCCCGAGCCAAACCCAAGG[T/C]GAGGAAATGTTTAGACACATCCTTCAGGCTAAACTGACACTGCCTACAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link