nipsnap1

Ensembl ID:
ENSDARG00000005320
ZFIN ID:
ZDB-GENE-991008-17
Description:
protein NipSnap homolog 1 [Source:RefSeq peptide;Acc:NP_571108]
Human Orthologue:
NIPSNAP1
Human Description:
nipsnap homolog 1 (C. elegans) [Source:HGNC Symbol;Acc:7827]
Mouse Orthologue:
Nipsnap1
Mouse Description:
4-nitrophenylphosphatase domain and non-neuronal SNAP25-like protein homolog 1 (C. elegans) Gene [So

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33542 Nonsense Mutation detected in F1 DNA During 2017
sa26414 Nonsense Available for shipment Available now
sa14357 Nonsense Available for shipment Available now
sa20352 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33542
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026749 Nonsense 38 278 2 10
Genomic Location (Zv9):
Chromosome 5 (position 13141462)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 11552865
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTTGTGAATCCTCAGAGGTTTTGCGAATAAAAGTGACGAAGGCTGGT[T/A]GAGTTCCATGTTTGCACACAAAGTGGATGCCAGGAAAGATGCCCACTCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26414
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026749 Nonsense 98 278 4 10
Genomic Location (Zv9):
Chromosome 5 (position 13135693)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 11547096
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTAATTTGAGGGACGAGGTGCAGAAGGAGCTCCATCATGATACAGATTA[T/A]CCCTGTGAAGTTGTTGGAAGCTGGAACACATGGTACGGTGAACAGGATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14357
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026749 Nonsense 184 278 6 10
Genomic Location (Zv9):
Chromosome 5 (position 13133097)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 11544500
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGAACCTGTGCCRAGAAGCGGCTCCAACATTTATGAACTCAGATCATA[T/A]CAGCTACTGGTAAAAGACATTMARTTGTTGTSCTTTATAATGTANNNNATTTAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20352
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026749 Essential Splice Site 258 278 9 10
Genomic Location (Zv9):
Chromosome 5 (position 13126807)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 11538210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGCTGCTTGGGAAAAAGAGGGCTGGGACGTCAGTGTGCACTATACAAG[T/C]GAGTAAGAGTGAAAACAAGAGGATATTTGAGAAAAATAAAAACCTGAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link