celf1

Ensembl ID:
ENSDARG00000005315
ZFIN ID:
ZDB-GENE-000501-1
Description:
CUGBP Elav-like family member 1 [Source:UniProtKB/Swiss-Prot;Acc:Q9IBD0]
Human Orthologue:
CELF1
Human Description:
CUGBP, Elav-like family member 1 [Source:HGNC Symbol;Acc:2549]
Mouse Orthologue:
Celf1
Mouse Description:
CUGBP, Elav-like family member 1 Gene [Source:MGI Symbol;Acc:MGI:1342295]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21022 Essential Splice Site Mutation detected in F1 DNA During 2014
sa1640 Nonsense F2 line generated During 2014
sa11143 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018448 None 148 501 7 16
ENSDART00000041055 Essential Splice Site 186 534 None 16
ENSDART00000123170 None 186 535 5 14
ENSDART00000132169 None 175 528 5 13
ENSDART00000134570 None 148 501 6 15
ENSDART00000139187 Essential Splice Site 148 216 None 8
ENSDART00000143815 None 148 169 6 7
Genomic Location:
Chromosome 7 (position 39944327)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCAAATCGAGGAGTGCCGCATATTGAGAGGTCCAGACGGACTAAGCCG[T/C]GGTGAGAGCCATCTAAAACACACGTACAATGTCATTATCATCATTTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1640
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018448 Nonsense 207 501 9 16
ENSDART00000041055 Nonsense 244 534 9 16
ENSDART00000123170 Nonsense 245 535 7 14
ENSDART00000132169 Nonsense 234 528 7 13
ENSDART00000134570 Nonsense 207 501 8 15
ENSDART00000139187 Nonsense 206 216 8 8
ENSDART00000143815 None None 169 None 7
Genomic Location:
Chromosome 7 (position 39942203)
KASP Assay ID:
554-1580.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGATAAAGAACAGAAACGCATCGCCCAGCAGCTGCAGCAACAGATGCAA[C/T]AGCTCAATGCTGCCTCCATGTGGGGAAACCTTACAGGGCTGAACTCACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11143
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018448 Nonsense 236 501 10 16
ENSDART00000041055 Nonsense 269 534 10 16
ENSDART00000123170 Nonsense 270 535 8 14
ENSDART00000132169 Nonsense 263 528 8 13
ENSDART00000134570 Nonsense 236 501 9 15
ENSDART00000139187 None None 216 None 8
ENSDART00000143815 None None 169 None 7
Genomic Location:
Chromosome 7 (position 39940929)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTCTGTTCTCTGTTTTGAWGTAATGTCTAGCTTTATTTGCAGCTTCTA[C/T]AGCAGTCTGCTTCCTCTGGAAATGCGCTCAACAATCTCCATCCAATGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0xfr2ifg