rad52

Ensembl ID:
ENSDARG00000005274
ZFIN IDs:
ZDB-GENE-050731-10, ZDB-GENE-050731-10
Description:
RAD52 homolog [Source:RefSeq peptide;Acc:NP_001019622]
Human Orthologue:
RAD52
Human Description:
RAD52 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:9824]
Mouse Orthologue:
Rad52
Mouse Description:
RAD52 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:101949]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44297 Nonsense Mutation detected in F1 DNA During 2017
sa38067 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44297
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017488 Nonsense 109 409 4 10
ENSDART00000079012 Nonsense 109 434 4 11
Genomic Location (Zv9):
Chromosome 25 (position 21772807)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21004683
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCAATGGGAAGTTTTACGTTGGAGTCAGTGCTTTCATTAAGGTCCAGT[T/G]AAAGGTAAGAGCTCTGACAATACAGAAGTACAGAGTTGTGAGTAGCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38067
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017488 Nonsense 129 409 5 10
ENSDART00000079012 Nonsense 129 434 5 11
Genomic Location (Zv9):
Chromosome 25 (position 21772938)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 21004814
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCATTTCATGAGGATGTAGGATATGGGGTCAGCGAAGGCCTCAAATCC[A/T]AAGCTCTGTCCCTGGAAAAAGCAAGAAAAGAAGCTGTCACAGATGGATTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Lung cancer: Influence of common genetic variation on lung cancer risk: meta-analysis of 14 900 cases and 29 485 controls. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link