LOC798235

Ensembl ID:
ENSDARG00000005271
Human Orthologue:
ZC3H12A
Human Description:
zinc finger CCCH-type containing 12A [Source:HGNC Symbol;Acc:26259]
Mouse Orthologue:
Zc3h12a
Mouse Description:
zinc finger CCCH type containing 12A Gene [Source:MGI Symbol;Acc:MGI:2385891]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42648 Nonsense Mutation detected in F1 DNA During 2017
sa30998 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42648
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061720 Nonsense 14 579 1 5
ENSDART00000061720 Nonsense 14 579 1 5
Genomic Location (Zv9):
Chromosome 16 (position 4968325)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 4186127
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGGCATCAATATGCAGTCCAGGTGTTTCCATCAACCCACAGGCCTGGGC[C/T]AGGACTCACACGACCTCCTCAACCTGCAGATGAAGGTGGACTTCTTCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30998
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061720 Nonsense 14 579 1 5
ENSDART00000061720 Nonsense 14 579 1 5
Genomic Location (Zv9):
Chromosome 16 (position 4968325)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 4186127
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGGCATCAATATGCAGTCCAGGTGTTTCCATCAACCCACAGGCCTGGGC[C/T]AGGACTCACACGACCTCCTCAACCTGCAGATGAAGGTGGACTTCTTCCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link