rpe

Ensembl ID:
ENSDARG00000005251
ZFIN ID:
ZDB-GENE-030131-6837
Description:
ribulose-phosphate 3-epimerase [Source:RefSeq peptide;Acc:NP_958469]
Human Orthologue:
RPE
Human Description:
ribulose-5-phosphate-3-epimerase [Source:HGNC Symbol;Acc:10293]
Mouse Orthologue:
Rpe
Mouse Description:
ribulose-5-phosphate-3-epimerase Gene [Source:MGI Symbol;Acc:MGI:1913896]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21487 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21487
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021218 Nonsense 57 228 2 6
ENSDART00000144163 Nonsense 5 137 1 5

The following transcripts of ENSDARG00000005251 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 25064000)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 24219786
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGCATTTTGTTCCAAACATCACATTTGGGCATCCAATGGTGGAATGTT[T/A]ACGAAGCTGTATCGGACCTGATCCATTTTTTGGTGAGTTCCAGTCTTTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link