asb3

Ensembl ID:
ENSDARG00000005246
ZFIN ID:
ZDB-GENE-030131-6142
Description:
ankyrin repeat and SOCS box protein 3 [Source:RefSeq peptide;Acc:NP_956168]
Human Orthologue:
ASB3
Human Description:
ankyrin repeat and SOCS box-containing 3 [Source:HGNC Symbol;Acc:16013]
Mouse Orthologue:
Asb3
Mouse Description:
ankyrin repeat and SOCS box-containing 3 Gene [Source:MGI Symbol;Acc:MGI:1929749]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3828 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3828
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021298 Essential Splice Site 468 519 8 9
ENSDART00000110173 Essential Splice Site 299 350 5 6
Genomic Location:
Chromosome 12 (position 25583461)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCGCTCACCGGCGAGCCGAGGGCACCTGGACACCACGTAAACATTTCGG[T/A]ATGACATTATTGTATGTTTGAGTGGGTGTGTTTACATGAGCATCAGTAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/44z5l2jp