NR_023320.1

Ensembl ID:
ENSDARG00000005236
Description:
im:7138264 (im:7138264), non-coding RNA [Source:RefSeq DNA;Acc:NR_023320]
Human Orthologue:
SRCAP
Human Description:
Snf2-related CREBBP activator protein [Source:HGNC Symbol;Acc:16974]
Mouse Orthologues:
AC122417.1, Srcap
Mouse Descriptions:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8BKT0]
Snf2-related CREBBP activator protein Gene [Source:MGI Symbol;Acc:MGI:2444036]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17300 Nonsense Available for shipment Available now
sa15343 Essential Splice Site Available for shipment Available now
sa8992 Nonsense Mutation detected in F1 DNA During 2017
sa22109 Essential Splice Site Available for shipment Available now
sa22110 Nonsense Available for shipment Available now
sa38898 Nonsense Mutation detected in F1 DNA During 2017
sa16953 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17300
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003080 Nonsense 1036 3917 5 32
Genomic Location (Zv9):
Chromosome 12 (position 28643081)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26980690
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTGCAGGGYGCCCCTGTACAGAGTTCAGACAYTGCAGCTGCCTCCAAA[C/T]AGTCACAGCCTAATCCTGTTGATGAGGATGGTGAGGATTGGCATTTGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15343
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003080 Essential Splice Site 1454 3917 13 32
Genomic Location (Zv9):
Chromosome 12 (position 28645385)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26982994
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAGAACTTTAAGTCCCAGCGCTGGCAAAGCCTGCTCAATTTTAACAGG[T/C]ACTTGAATACAACAATATCTGTTAAGGGCTTGATCATTTATTAWCAGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8992
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003080 Nonsense 2304 3917 26 32
Genomic Location (Zv9):
Chromosome 12 (position 28656248)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26993857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTACCATGGACACATCTATCTGAGGTTGGATGGAAGTACACGAGTGGAA[C/T]AGAGACAGGTGAAATACTAGTTCTAGTACTTTGGTAGTGTTTGCGATTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22109
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003080 Essential Splice Site 2450 3917 29 32
Genomic Location (Zv9):
Chromosome 12 (position 28656993)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26994602
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATGATGAGGAGTCCATCAATAAACAAAAAACCACCATTTTGGAACAG[G/A]TAAATTAAATGTATCTATTTGGGGTATTGAATTTGTTTTTCTTGCAAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22110
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003080 Nonsense 2816 3917 32 32
Genomic Location (Zv9):
Chromosome 12 (position 28658389)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26995998
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAAATTCTCAAGGGACTTCCAGAAGATTCTCCCTCAGCCAAGGTCCTT[C/T]GAAAGCTTCCAGGTCGTCTGGTCACTGTGGTGGAGGAGAAAGAGCCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38898
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003080 Nonsense 3161 3917 32 32
Genomic Location (Zv9):
Chromosome 12 (position 28659426)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26997035
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGTATCTTTACCACACAGCACCTCTACAGCAGCACCATATGAAACTTG[T/A]ACTGATTCTTCTCCTACACTACAGTTTACATATTCTTTCAGAGAGCCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16953
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003080 Nonsense 3169 3917 32 32
Genomic Location (Zv9):
Chromosome 12 (position 28659448)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26997057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTACAGCAGCACCMTATGAAACTTGTACTGATTCTTCTCCTACACTA[C/T]AGTTTACATATTCTTTCAGAGAGCCTCCAGTTACTACTGTTTCAATCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link