cpn1

Ensembl ID:
ENSDARG00000005185
ZFIN ID:
ZDB-GENE-030131-9116
Description:
carboxypeptidase N catalytic chain [Source:RefSeq peptide;Acc:NP_997935]
Human Orthologue:
CPN1
Human Description:
carboxypeptidase N, polypeptide 1 [Source:HGNC Symbol;Acc:2312]
Mouse Orthologue:
Cpn1
Mouse Description:
carboxypeptidase N, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:2135874]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11899 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa11899
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011461 Essential Splice Site None 450 2 15
ENSDART00000124439 None None 450 None 9

The following transcripts of ENSDARG00000005185 do not overlap with this mutation:

Genomic Location:
Chromosome 12 (position 33298382)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTATAATTCCTTGTTTCAATTGGTGCCTGCCAACTCCAGTTCCAAATG[G/A]TAACTATACATGTTTATTTCCATTTAACTGCTTCATGATATGAATTRTAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pbqp60uf