c14orf159

Ensembl ID:
ENSDARG00000005179
ZFIN ID:
ZDB-GENE-070725-6
Description:
C14orf159 protein [Source:UniProtKB/TrEMBL;Acc:A9JRU8]
Human Orthologue:
C14orf159
Human Description:
chromosome 14 open reading frame 159 [Source:HGNC Symbol;Acc:20498]
Mouse Orthologue:
9030617O03Rik
Mouse Description:
RIKEN cDNA 9030617O03 gene Gene [Source:MGI Symbol;Acc:MGI:2444813]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25046 Essential Splice Site Mutation detected in F1 DNA During 2014
sa14039 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25046
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062067 Essential Splice Site 200 617 None 12
ENSDART00000124041 Essential Splice Site 201 284 None 7
ENSDART00000136921 None None 164 None 4

The following transcripts of ENSDARG00000005179 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 38928132)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGCCATCCCACTGGCGCATGGAGGACCTGTTCATATTGGAGATCCTAG[T/G]ATGGACTTTTTTTTTAAAGAAAGTATATGATGGAACTTTATCTTGTTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14039
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000062067 Nonsense 491 617 10 12
ENSDART00000124041 None None 284 None 7
ENSDART00000136921 None None 164 None 4

The following transcripts of ENSDARG00000005179 do not overlap with this mutation:

Genomic Location:
Chromosome 17 (position 38914993)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGTGCGTGTGCAGGGATTGGAGATGGAGGTAATGAGCTTGGTATGGGT[A/T]AAGTCAAAGCAGCAGTTAAAGCCCACATGCCTAAYGGGAAGCTGATTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/2k6ga5wj