tpm3

Ensembl ID:
ENSDARG00000005162
ZFIN ID:
ZDB-GENE-030826-16
Description:
tropomyosin 3 isoform 2 [Source:RefSeq peptide;Acc:NP_958900]
Human Orthologues:
AC103988.1, TPM1, TPM2, TPM4
Human Descriptions:
tropomyosin 1 (alpha) [Source:HGNC Symbol;Acc:12010]
tropomyosin 2 (beta) [Source:HGNC Symbol;Acc:12011]
tropomyosin 4 [Source:HGNC Symbol;Acc:12013]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9JE83]
Mouse Orthologues:
Tpm1, Tpm2, Tpm3-rs7, Tpm4
Mouse Descriptions:
tropomyosin 1, alpha Gene [Source:MGI Symbol;Acc:MGI:98809]
tropomyosin 2, beta Gene [Source:MGI Symbol;Acc:MGI:98810]
tropomyosin 3, related sequence 7 Pseudogene [Source:MGI Symbol;Acc:MGI:99705]
tropomyosin 4 Gene [Source:MGI Symbol;Acc:MGI:2449202]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16993 Nonsense Available for shipment Available now
sa23465 Essential Splice Site Mutation detected in F1 DNA During 2014
sa9640 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16993
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010997 None None 248 None 8
ENSDART00000027598 Nonsense 6 284 1 10
ENSDART00000137865 Nonsense 6 81 2 3
Genomic Location:
Chromosome 19 (position 11521219)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTCGGACCGTRAGCCCTTCTCACCAACGCCAAGATGGAGGCCGTCAAG[A/T]AGAAGATGATGATGCTGAAGCTGGATAAGGAGAATGCTCTGGACCAGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23465
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010997 None None 248 None 8
ENSDART00000027598 Essential Splice Site 39 284 None 10
ENSDART00000137865 Essential Splice Site 39 81 None 3
Genomic Location:
Chromosome 19 (position 11518479)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCACTCTTTCAATCACAACCACTGTCAAATATCCCTTCTGTCTTCTCCC[A/T]GCATGAGGATGAGCTGATTCAGATGCAGAAGAAGCTGAAGGGAACTGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9640
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010997 Nonsense 178 248 6 8
ENSDART00000027598 Nonsense 214 284 7 10
ENSDART00000137865 None None 81 None 3
Genomic Location:
Chromosome 19 (position 11493070)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAAGACCCCACCCCAATTCATAGTGCTCCATTTGTTTTCCCTACAGTA[T/G]TCCCAGAAGGAGGACAAGTATGAGGAAGAAATCAAGATCCTCACTGATAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/aaw6xi0b