gpib

Ensembl ID:
ENSDARG00000005161
ZFIN ID:
ZDB-GENE-020513-3
Description:
glucose phosphate isomerase b [Source:RefSeq peptide;Acc:NP_658910]
Human Orthologue:
GPI
Human Description:
glucose-6-phosphate isomerase [Source:HGNC Symbol;Acc:4458]
Mouse Orthologues:
Gm1840, Gpi1
Mouse Descriptions:
glucose phosphate isomerase 1 Gene [Source:MGI Symbol;Acc:MGI:95797]
predicted gene 1840 Pseudogene [Source:MGI Symbol;Acc:MGI:3037698]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa35607 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35607
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020914 Nonsense 289 553 11 18
Genomic Location (Zv9):
Chromosome 13 (position 52008969)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 522577
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTCTGAGCGAATCGTAATCATCTGTCCAATCCCTTCTGTTGCAGGATA[T/A]GAGAACTTTGAGAAGCTGTTGGCTGGAGCTCATTGGATGGTGAGTTTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link