CYTH3 (1 of 3)

Ensembl ID:
ENSDARG00000005159
Description:
cytohesin 3 [Source:HGNC Symbol;Acc:9504]
Human Orthologue:
CYTH3
Human Description:
cytohesin 3 [Source:HGNC Symbol;Acc:9504]
Mouse Orthologue:
Cyth3
Mouse Description:
cytohesin 3 Gene [Source:MGI Symbol;Acc:MGI:1335107]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10350 Essential Splice Site Available for shipment Available now
sa8572 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10350
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050576 Essential Splice Site 148 401 6 14
Genomic Location:
Chromosome 3 (position 56853551)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGTGGAGCTCCACGAATTTGCCGACCTCAACCTCGTTCAGGCTCTGAG[G/A]TGGGAAAACTGTTCATTTCCTCCAAAAATGCTTGAATTTATTACATTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8572
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050576 Nonsense 284 401 10 14
Genomic Location:
Chromosome 3 (position 56828394)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTGATTTGCTTTGCAGGTGGACGGGTAAAAACTTGGAAGAGGCGATG[G/A]TTTATTCTCACCGACAACTGCTTGTACTATTTTGAGTACACAACGGTAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j3kt67jh