psmd11b

Ensembl ID:
ENSDARG00000005134
ZFIN ID:
ZDB-GENE-030131-984
Description:
26S proteasome non-ATPase regulatory subunit 11 [Source:RefSeq peptide;Acc:NP_955886]
Human Orthologue:
PSMD11
Human Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 [Source:HGNC Symbol;Acc:9556]
Mouse Orthologue:
Psmd11
Mouse Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 11 Gene [Source:MGI Symbol;Acc:MGI:1916327]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42046 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42046
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016283 Nonsense 270 422 7 13
Genomic Location (Zv9):
Chromosome 12 (position 29902399)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 28239336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAAATTTCAAAGTGTTCATCTTTTTCAGACCAGAAGAGGTACAGGCTT[T/A]GATCAGCGGCAAACTTGGTCTGCGATATGCAGGGAGACAGGTAAGCTCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link