rnaseh2b

Ensembl ID:
ENSDARG00000005128
ZFIN ID:
ZDB-GENE-040426-1090
Description:
ribonuclease H2, subunit B [Source:RefSeq peptide;Acc:NP_956565]
Human Orthologue:
RNASEH2B
Human Description:
ribonuclease H2, subunit B [Source:HGNC Symbol;Acc:25671]
Mouse Orthologue:
Rnaseh2b
Mouse Description:
ribonuclease H2, subunit B Gene [Source:MGI Symbol;Acc:MGI:1914403]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21501 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21501
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015377 Nonsense 122 306 5 11
ENSDART00000145042 Nonsense 41 82 2 6

The following transcripts of ENSDARG00000005128 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 30710440)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 29866386
KASP Assay ID:
2260-1944.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCACAGGGAAAGTTCCAGTCGGTGAAGCAGATGGTGATGGATGAGGATTA[T/A]CCCGGCTGCTCAAGACTTCTGCAATGCAAACAGGGTCTAGACTCCCTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link