atp2a2b

Ensembl ID:
ENSDARG00000005122
ZFIN ID:
ZDB-GENE-030131-867
Description:
ATPase, Ca++ transporting, cardiac muscle, slow twitch 2b [Source:RefSeq peptide;Acc:NP_001025448]
Human Orthologue:
ATP2A2
Human Description:
ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 [Source:HGNC Symbol;Acc:812]
Mouse Orthologue:
Atp2a2
Mouse Description:
ATPase, Ca++ transporting, cardiac muscle, slow twitch 2 Gene [Source:MGI Symbol;Acc:MGI:88110]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23896 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23896
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047201 Nonsense 606 1035 13 19
Genomic Location:
Chromosome 21 (position 15608319)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCATGTTGGATCCGCCCAGAGCAGAGGTCGCAGCTTCCATCAAACTCTG[T/A]CGTCAAGCAGGAATCCGAGTCATCATGATCACCGGTGACAACAAGGGTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/k0jx46rl