calub

Ensembl ID:
ENSDARG00000005115
ZFIN ID:
ZDB-GENE-040426-1251
Description:
Calumenin-B [Source:UniProtKB/Swiss-Prot;Acc:Q7SXV9]
Human Orthologue:
CALU
Human Description:
calumenin [Source:HGNC Symbol;Acc:1458]
Mouse Orthologue:
Calu
Mouse Description:
calumenin Gene [Source:MGI Symbol;Acc:MGI:1097158]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32186 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32186
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005405 Essential Splice Site 138 315 3 7
ENSDART00000127138 Essential Splice Site 138 332 2 7
Genomic Location (Zv9):
Chromosome 18 (position 6112832)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 7067933
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGTCTCCTGGGAGGAATACAAGAATGCTACGTATGGTTACATACTTG[G/A]TGCGTATAGAGTAAAGCTTTTGCTCATGGTGCACATAAATGTAATGTGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link