cdh17

Ensembl ID:
ENSDARG00000005112
ZFIN ID:
ZDB-GENE-030910-3
Description:
cadherin-17 [Source:RefSeq peptide;Acc:NP_919403]
Human Orthologue:
CDH17
Human Description:
cadherin 17, LI cadherin (liver-intestine) [Source:HGNC Symbol;Acc:1756]
Mouse Orthologue:
Cdh17
Mouse Description:
cadherin 17 Gene [Source:MGI Symbol;Acc:MGI:1095414]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32091 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36153 Nonsense Mutation detected in F1 DNA During 2016
sa14279 Essential Splice Site Available for shipment Available now
sa11932 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32091
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042895 Essential Splice Site 93 868 None 19

The following transcripts of ENSDARG00000005112 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 29033164)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26908938
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGGAGCAACCTCTGGAATGGAGCCCTGAGAAAAAACACCATCTACTTG[T/C]AATTTAGTATTGCAGTCTAAAACACAACACAAAAAAATACAAGAACTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36153
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042895 Nonsense 186 868 6 19

The following transcripts of ENSDARG00000005112 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 29035467)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26911241
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCCATTGTCGGGCAAACATTTTTCTTTGGCATAAATCCAAACAATGGA[C/T]AGATATTTACAACAGAAGAAGGTACGGCAACATATATATGAACAAGAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14279
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042895 Essential Splice Site 501 868 12 19

The following transcripts of ENSDARG00000005112 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 29043799)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26919573
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAGGTGAWCGAYATCAATGATGAGATCCCTATCTTCGAGAAAAACGATG[T/A]ATGTGCTTWTATTTKACTACCTACATAAACTGCGATCAATAGGTTGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11932
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000042895 Nonsense 716 868 16 19

The following transcripts of ENSDARG00000005112 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 29047374)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26923148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAGGTGGACATTYATCTGCAGGATGTAAACKACAACTACCCTAAACTC[C/T]AGAAGACACAGGGCTTCATCTGCCTTCAGGACATGACCCCCTTGACCCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link