limk2

Ensembl ID:
ENSDARG00000005104
ZFIN ID:
ZDB-GENE-040718-398
Description:
LIM domain kinase 2 [Source:RefSeq peptide;Acc:NP_001002651]
Human Orthologue:
LIMK2
Human Description:
LIM domain kinase 2 [Source:HGNC Symbol;Acc:6614]
Mouse Orthologue:
Limk2
Mouse Description:
LIM motif-containing protein kinase 2 Gene [Source:MGI Symbol;Acc:MGI:1197517]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16581 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16581
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000093185 Nonsense 579 651 15 16
ENSDART00000142894 None None 219 None 7

The following transcripts of ENSDARG00000005104 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 22643005)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGGGCTGAATGTGCGAACSTTCATYGAGAAGTTTCTTCCTGAGCACTG[T/A]CCTCCTGCTTTCTTTGCATTGGCTGTGGCCTGTTGTGACCTCACTCCTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qrfsnq48