glcea

Ensembl ID:
ENSDARG00000005095
ZFIN ID:
ZDB-GENE-040630-9
Description:
glucuronyl C5-epimerase a [Source:RefSeq peptide;Acc:NP_998015]
Human Orthologue:
GLCE
Human Description:
glucuronic acid epimerase [Source:HGNC Symbol;Acc:17855]
Mouse Orthologue:
Glce
Mouse Description:
glucuronyl C5-epimerase Gene [Source:MGI Symbol;Acc:MGI:2136405]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1666 Nonsense Available for shipment Available now
sa8517 Nonsense Mutation detected in F1 DNA During 2014
sa16942 Nonsense Available for shipment Available now
sa12861 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1666
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014274 Nonsense 205 585 3 4
Genomic Location:
Chromosome 25 (position 8183906)
KASP Assay ID:
554-1613.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCACTACAGCAAGAACCTCACAGAGAAACCTCCTGACATAAAGATCTA[T/A]GGCATGTTAGAGGAAAAAGAGGGTGGCTCAAGTCAGTGGGATGTCCCTAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa8517
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014274 Nonsense 528 585 4 4
Genomic Location:
Chromosome 25 (position 8182856)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCRCTCAAGGCCATGTTGCCATTGTTCGATACAGGCTCTGGAACAGTTTA[T/G]GACCTGAGACACTTTACCTTGGGTGTTGCCCCRAATTTAGCACGRTGGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16942
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014274 Nonsense 535 585 4 4
ENSDART00000014274 Nonsense 535 585 4 4
Genomic Location:
Chromosome 25 (position 8182836)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTTCGATACAGGCTCTGGAACAGTTTAKGACYTGAGACACTTTACCT[T/A]GGGTGTTGCCCCRAATTTAGCACGRTGGGACTATCACAYCACGCACATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12861
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014274 Nonsense 535 585 4 4
ENSDART00000014274 Nonsense 535 585 4 4
Genomic Location:
Chromosome 25 (position 8182836)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTTCGATACAGGCTCTGGAACAGTTTAKGACCTGAGACACTTTACCT[T/A]GGGTGTTGCCCCRAATTTAGCACGRTGGGACTATCACAYCACGCACATCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1tvmkkvd