ccdc123

Ensembl ID:
ENSDARG00000005092
ZFIN ID:
ZDB-GENE-040426-1210
Description:
Coiled-coil domain-containing protein 123, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q6P402]
Human Orthologue:
CCDC123
Human Description:
coiled-coil domain containing 123 [Source:HGNC Symbol;Acc:25907]
Mouse Orthologue:
Ccdc123
Mouse Description:
coiled-coil domain containing 123 Gene [Source:MGI Symbol;Acc:MGI:1919390]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12407 Nonsense Available for shipment Available now
sa18881 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa12407
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007365 Nonsense 197 695 5 19
ENSDART00000138669 Nonsense 213 711 5 19
Genomic Location:
Chromosome 7 (position 39790344)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTGATGAAGAGACTGAAGACTCTGCATTTGATATTGTGTCCCCTCTA[C/T]AGACTGAAGGTTTGGAAYAATAATAATTTTACTACAATTTGAAATAAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18881
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007365 Essential Splice Site 394 695 11 19
ENSDART00000138669 Essential Splice Site 410 711 11 19
Genomic Location:
Chromosome 7 (position 39813522)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTCAGCTTAAGGGCCTACCAGTGAAAGGACCTGCACCTCCGTGGCTGG[T/G]ATGTATTGTATTCTATAGATTTCAGTGTATGCTTCTTCTGTTGATTTCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/esfsz544