ccdc123

Ensembl ID:
ENSDARG00000005092
ZFIN ID:
ZDB-GENE-040426-1210
Description:
Coiled-coil domain-containing protein 123, mitochondrial [Source:UniProtKB/Swiss-Prot;Acc:Q6P402]
Human Orthologue:
CCDC123
Human Description:
coiled-coil domain containing 123 [Source:HGNC Symbol;Acc:25907]
Mouse Orthologue:
Ccdc123
Mouse Description:
coiled-coil domain containing 123 Gene [Source:MGI Symbol;Acc:MGI:1919390]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12407 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12407
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007365 Nonsense 197 695 5 19
ENSDART00000138669 Nonsense 213 711 5 19
Genomic Location (Zv9):
Chromosome 7 (position 39790344)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 38126984
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTGATGAAGAGACTGAAGACTCTGCATTTGATATTGTGTCCCCTCTA[C/T]AGACTGAAGGTTTGGAAYAATAATAATTTTACTACAATTTGAAATAAGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link