ncapd2

Ensembl ID:
ENSDARG00000005058
ZFIN ID:
ZDB-GENE-050506-59
Description:
condensin complex subunit 1 [Source:RefSeq peptide;Acc:NP_001155974]
Human Orthologue:
NCAPD2
Human Description:
non-SMC condensin I complex, subunit D2 [Source:HGNC Symbol;Acc:24305]
Mouse Orthologue:
Ncapd2
Mouse Description:
non-SMC condensin I complex, subunit D2 Gene [Source:MGI Symbol;Acc:MGI:1915548]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12163 Essential Splice Site Available for shipment Available now
sa6859 Nonsense Mutation detected in F1 DNA During 2017
sa19860 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12163
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027088   None 507 None 14
ENSDART00000098126 Essential Splice Site 553 1389 13 33
ENSDART00000113351 Essential Splice Site 530 1380 13 32

The following transcripts of ENSDARG00000005058 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 44830325)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44915826
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGACWCYGCTGTCCAAATCGCTCAGTTTCTCMGAGAAAGCAAATACAAG[T/G]AMATGTCCATTAATTAACACKGATTCTCTTATCCCCTAATACTGGACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6859
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027088   None 507 None 14
ENSDART00000098126 Nonsense 876 1389 21 33
ENSDART00000113351 Nonsense 852 1380 21 32

The following transcripts of ENSDARG00000005058 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 44823872)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44909373
KASP Assay ID:
554-4008.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCAACAGGAGTGGTCCAGTCAGACCCCCATTGGCAGACCTTCATGGAA[C/T]AGGCCGTTCGTCTGATCTACTTYCTAGCAGAGTCGCCTGACCAGCTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19860
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027088   None 507 None 14
ENSDART00000098126 Nonsense 1269 1389 30 33
ENSDART00000113351 Nonsense 1260 1380 29 32

The following transcripts of ENSDARG00000005058 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 44815249)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 44900750
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGAGCCTGGAGTCTATCAGCCCCTGCTGTCCATCGCTGCCAAACTCCGT[C/T]GAAGAGCCAAACCACAGTTTAAGGCATGTTATGAGCATTAATGAAGCTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link