dimt1l

Ensembl ID:
ENSDARG00000005057
ZFIN ID:
ZDB-GENE-040801-75
Description:
probable dimethyladenosine transferase [Source:RefSeq peptide;Acc:NP_001003556]
Human Orthologue:
DIMT1L
Human Description:
DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) [Source:HGNC Symbol;Acc:30217]
Mouse Orthologue:
Dimt1
Mouse Description:
DIM1 dimethyladenosine transferase 1-like (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1913504]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7126 Splice Site, Nonsense Mutation detected in F1 DNA During 2017
sa34362 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa7126
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050228 Splice Site, Nonsense 44 306 2 12
ENSDART00000140531 Splice Site, Nonsense 44 306 2 12
Genomic Location (Zv9):
Chromosome 8 (position 17705892)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17150780
KASP Assay ID:
554-5131.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGGTCAGCATATTTTGAAAAACCCTTTGGTTGTCAACGGCATCATAGAG[A/T]AGGTCAGTAATAGGGATTATGAGTTTTTCTGGATTGTTKGTCTATTTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34362
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050228 Essential Splice Site 293 306 11 12
ENSDART00000140531 Essential Splice Site 293 306 11 12
Genomic Location (Zv9):
Chromosome 8 (position 17711064)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17155952
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTCAGTGATAAGAGGGCACGTTCCATGGATATAGATGATTTCATGGTG[T/C]AAGTATAACCCGCTTCACTTCATGTACATTTTGTGTTTTGGGGGTGTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link