trip4

Ensembl ID:
ENSDARG00000005033
ZFIN ID:
ZDB-GENE-040724-92
Description:
thyroid hormone receptor interactor 4 [Source:RefSeq peptide;Acc:NP_001071043]
Human Orthologue:
TRIP4
Human Description:
thyroid hormone receptor interactor 4 [Source:HGNC Symbol;Acc:12310]
Mouse Orthologue:
Trip4
Mouse Description:
thyroid hormone receptor interactor 4 Gene [Source:MGI Symbol;Acc:MGI:1928469]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41030 Nonsense Mutation detected in F1 DNA During 2016
sa13764 Essential Splice Site Available for shipment Available now
sa34195 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa41030
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030273 Nonsense 234 515 6 12
ENSDART00000126674 Nonsense 234 564 6 13
Genomic Location:
Chromosome 7 (position 56063931)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATCAGGGTCGTTTTTTTGTGTGGTCCCAGAGGGAACCGAGCGAGAGTA[T/A]CTGCCCCACCAAGAGTCCAAGATGAAGGCTGGTCTGGAAAAAGCTGTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13764
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030273 Essential Splice Site 377 515 8 12
ENSDART00000126674 Essential Splice Site 377 564 8 13
Genomic Location:
Chromosome 7 (position 56059462)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAYTTCAGAGAGYTCGTCAACCCCAATATTCTACAGTCTGCACCAGAGG[T/C]ACATGCAAACTCTCAAGTGCATRTAAGATCAGTGCCATTCATATTCGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34195
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000030273 Essential Splice Site 481 515 10 12
ENSDART00000126674 Essential Splice Site 481 564 10 13
Genomic Location:
Chromosome 7 (position 56054517)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGAAATTGCAGAGGTAGAGGCCATGTACCGCCACCTTTACAAGCATGG[T/G]ATGTTTACTAATATACTAAACCTGTTAAACCTAAATAATCCCTTCATGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link