tshz1

Ensembl ID:
ENSDARG00000005026
ZFIN ID:
ZDB-GENE-030820-3
Description:
Teashirt homolog 1 [Source:UniProtKB/Swiss-Prot;Acc:B3DJM5]
Human Orthologue:
TSHZ1
Human Description:
teashirt zinc finger homeobox 1 [Source:HGNC Symbol;Acc:10669]
Mouse Orthologue:
Tshz1
Mouse Description:
teashirt zinc finger family member 1 Gene [Source:MGI Symbol;Acc:MGI:1346031]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14913 Nonsense Available for shipment Available now
sa39242 Nonsense Mutation detected in F1 DNA During 2016
sa91 Nonsense Confirmed mutation in F2 line During 2016
sa36825 Nonsense Mutation detected in F1 DNA During 2016
sa6555 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14913
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024639 Nonsense 349 1158 1 1
ENSDART00000122002 Nonsense 43 852 1 1
Genomic Location (Zv9):
Chromosome 19 (position 21892177)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 21825557
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGCGATCCTTAATGGAGATGGAGGGTAAAGAAGATGCACAGAAAGTTT[T/A]GAAATGCATGTATTGTGGCCACTYGTTTGAATCYCTACAAGACTTGAGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39242
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024639 Nonsense 441 1158 1 1
ENSDART00000122002 Nonsense 135 852 1 1
Genomic Location (Zv9):
Chromosome 19 (position 21892454)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 21825834
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAAAGATCCAAAAATTTCAAATCCATACGTCACGGCTAATAACCGTTA[T/A]GGCTACCAAAATGGTGCAAGTTATACCTGGCAGTTTGAGGCCAGAAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa91
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024639 Nonsense 550 1158 1 1
ENSDART00000122002 Nonsense 244 852 1 1
Genomic Location (Zv9):
Chromosome 19 (position 21892779)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 21826159
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCAATACACCCCTCCATTATGGATGATCGGAAGGAGTTGGAAGAAGAG[A/T]AATTTGAGGAACCTGAGGAAAAGAAAATCAAGCAAGAGAAGGAAGACCCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa36825
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024639 Nonsense 713 1158 1 1
ENSDART00000122002 Nonsense 407 852 1 1
Genomic Location (Zv9):
Chromosome 19 (position 21893268)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 21826648
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATTCCATCAAAGAAAGACAGGGATGAAAAATTAACTGAACGTAATTCC[A/T]AACATCTTACTGCTGAATTACCCTCTCCGGTTCTCAAAGAGAGAAAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6555
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024639 Nonsense 1075 1158 1 1
ENSDART00000122002 Nonsense 769 852 1 1
Genomic Location (Zv9):
Chromosome 19 (position 21894355)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 21827735
KASP Assay ID:
554-4558.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCCCTCCACATACATTAACCACTTAGAGTCYCATTTGGGCTTTAGTT[T/A]GAAGGACCTCTCAAAGTTATCAATAGACCTCATAAGAGACCAGCAAGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link