fkbp9

Ensembl ID:
ENSDARG00000005023
ZFIN ID:
ZDB-GENE-040801-23
Description:
peptidyl-prolyl cis-trans isomerase FKBP9 [Source:RefSeq peptide;Acc:NP_001003520]
Human Orthologue:
FKBP9
Human Description:
FK506 binding protein 9, 63 kDa [Source:HGNC Symbol;Acc:3725]
Mouse Orthologue:
Fkbp9
Mouse Description:
FK506 binding protein 9 Gene [Source:MGI Symbol;Acc:MGI:1350921]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23588 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23588
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004392 Essential Splice Site 179 564 3 10
Genomic Location:
Chromosome 19 (position 44205724)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTACCACTACAATGGCACTCTGCTTGATGGCACGCTGTTCGACTCCAG[G/A]TGAGATCATTTGTGTGGACCTAATAAAACAACATAAATAGTTTTTATTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6g1ds6fy