brf1b

Ensembl ID:
ENSDARG00000005002
ZFIN ID:
ZDB-GENE-030131-6248
Description:
transcription factor IIIB 90 kDa subunit [Source:RefSeq peptide;Acc:NP_956183]
Human Orthologue:
BRF1
Human Description:
BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) [So
Mouse Orthologue:
Brf1
Mouse Description:
BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) Gen

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43418 Nonsense Mutation detected in F1 DNA During 2016
sa37009 Nonsense Mutation detected in F1 DNA During 2016
sa9022 Essential Splice Site Mutation detected in F1 DNA During 2016
sa11693 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa43418
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035827 Nonsense 398 693 12 19

The following transcripts of ENSDARG00000005002 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 21020184)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21048351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCATAAGTCAGGTGCTTAACCGAAGAGACCAGGGAGGAAAGAAGGATT[T/A]AGATGGAAGAAAGAACACAGTCCCGCTTCCTAATCAGTCCAAACATGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37009
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035827 Nonsense 437 693 12 19

The following transcripts of ENSDARG00000005002 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 21020300)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21048467
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGGCCCTCTGCCCAGTGCTGCCAGCCTTGGTTTAACAGACTCCATTAGA[C/T]AATGCATCACAGAGACAACAAATGGTGAGTGTGCCACTTAATGGTGCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035827 Essential Splice Site 511 693 15 19

The following transcripts of ENSDARG00000005002 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 21050454)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21078621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGGAGAGAATTGCTAAAGARAAGGAACAGGGRACCTATAAGGAGAAG[G/A]TGAGTGTGTGTGTGNNTCTGGCTTTTTCTTACYATTTCKGCAGGAGCTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11693
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035827 Essential Splice Site 511 693 15 19

The following transcripts of ENSDARG00000005002 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 21050454)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 21078621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGGAGAGAATTGCTAAAGARAAGGAACAGGGRACCTATAAGGAGAAG[G/A]TGAGTGTGTGTGTGNNTCTGGMTTTTTCTTACYATTTCKGCAGGAGCTTTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link