brf1b

Ensembl ID:
ENSDARG00000005002
ZFIN ID:
ZDB-GENE-030131-6248
Description:
transcription factor IIIB 90 kDa subunit [Source:RefSeq peptide;Acc:NP_956183]
Human Orthologue:
BRF1
Human Description:
BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) [So
Mouse Orthologue:
Brf1
Mouse Description:
BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae) Gen

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3097 Nonsense Mutation detected in F1 DNA During 2014
sa3103 Nonsense Mutation detected in F1 DNA During 2014
sa9022 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11693 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa3097
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035827 Nonsense 24 693 2 19

The following transcripts of ENSDARG00000005002 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 20974799)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGGTGGATCGGACATCGACACAGATCCAGCCCGGGGGAGTGCAGTCTG[C/A]ACAGCCTGTGGTTCGGTTCTGGAGGAYAACATCATTGTGTCTGAGGTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3103
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035827 Nonsense 188 693 7 19

The following transcripts of ENSDARG00000005002 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 21009495)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTACAGATCTGTTGGTTTCTATTTTTAGATCCATGTCTGTACATTCCA[C/T]GATTCGCCCACATGTTGGAGTTTGGTGAAAAGACCCATGAGGTTTCGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035827 Essential Splice Site 511 693 15 19

The following transcripts of ENSDARG00000005002 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 21050454)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGGAGAGAATTGCTAAAGARAAGGAACAGGGRACCTATAAGGAGAAG[G/A]TGAGTGTGTGTGTGNNTCTGGCTTTTTCTTACYATTTCKGCAGGAGCTTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11693
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035827 Essential Splice Site 511 693 15 19

The following transcripts of ENSDARG00000005002 do not overlap with this mutation:

Genomic Location:
Chromosome 20 (position 21050454)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGGAGAGAATTGCTAAAGARAAGGAACAGGGRACCTATAAGGAGAAG[G/A]TGAGTGTGTGTGTGNNTCTGGMTTTTTCTTACYATTTCKGCAGGAGCTTTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4vj5r90x