ppp3ca

Ensembl ID:
ENSDARG00000004988
ZFIN IDs:
ZDB-GENE-050417-406, ZDB-GENE-091113-24
Description:
protein phosphatase 3, catalytic subunit, alpha isozyme [Source:RefSeq peptide;Acc:NP_001185479]
Human Orthologues:
PPP3CA, PPP3CB
Human Descriptions:
protein phosphatase 3, catalytic subunit, alpha isozyme [Source:HGNC Symbol;Acc:9314]
protein phosphatase 3, catalytic subunit, beta isozyme [Source:HGNC Symbol;Acc:9315]
Mouse Orthologues:
Ppp3ca, Ppp3cb
Mouse Descriptions:
protein phosphatase 3, catalytic subunit, alpha isoform Gene [Source:MGI Symbol;Acc:MGI:107164]
protein phosphatase 3, catalytic subunit, beta isoform Gene [Source:MGI Symbol;Acc:MGI:107163]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29618 Essential Splice Site Mutation detected in F1 DNA During 2017
sa23963 Nonsense Available for shipment Available now
sa44970 Nonsense Mutation detected in F1 DNA During 2017
sa37336 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29618
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005929 Essential Splice Site 19 521 2 14
ENSDART00000144331 Essential Splice Site 19 505 2 13
Genomic Location (Zv9):
Chromosome 21 (position 28401737)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 28970648
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACTATGACACACAAGTTCTGATCTATTGTTTGCGTTCTTGCTCCTCTC[A/T]GCCGTTCCCTTCCCCCTGAGCCACCGCCTCACCATGAAGGAGGTGTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23963
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005929 Nonsense 111 521 3 14
ENSDART00000144331 Nonsense 111 505 3 13
Genomic Location (Zv9):
Chromosome 21 (position 28433615)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 29002526
KASP Assay ID:
2261-5758.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTGACCTGATGAAGCTGTTCGAGGTCGGTGGATCTCCAGCCACGACA[C/T]GATACCTCTTCCTGGGAGATTATGTGGACCGGGGCTACTTCAGTATCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44970
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005929 Nonsense 283 521 7 14
ENSDART00000144331 Nonsense 283 505 7 13
Genomic Location (Zv9):
Chromosome 21 (position 28454274)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTCCTACAGAATAATAACTTGTTATCAATCATTCGAGCGCACGAAGCA[C/T]AAGATGCAGGGTACGTTTTTGCAATCTGTCTTTGTAGCAATAAATACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37336
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005929 Essential Splice Site 386 521 11 14
ENSDART00000144331 Essential Splice Site 386 505 11 13
Genomic Location (Zv9):
Chromosome 21 (position 28460633)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 29029544
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTGGTCATCCAGAATGAGACTGCTTCATTTTTCTTTTTTCCGCCCACA[G/A]CAAATGCAGCAGCTGCTCGGAAAGAGGTGATTAGGAACAAGATCCGTGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Blood pressure: Genome-wide linkage and association scans for pulse pressure in Chinese twins. (View Study)
  • Corneal structure: A genome-wide association study identifies a potential novel gene locus for keratoconus, one of the commonest causes for corneal transplantation in developed countries. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link