elovl5

Ensembl ID:
ENSDARG00000004979
ZFIN ID:
ZDB-GENE-040407-2
Description:
elongation of very long chain fatty acids protein 5 [Source:RefSeq peptide;Acc:NP_956747]
Human Orthologue:
ELOVL5
Human Description:
ELOVL family member 5, elongation of long chain fatty acids (FEN1/Elo2, SUR4/Elo3-like, yeast) [Sour
Mouse Orthologue:
Elovl5
Mouse Description:
ELOVL family member 5, elongation of long chain fatty acids (yeast) Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3879 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3879
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006990 Essential Splice Site 20 291 3 8
Genomic Location:
Chromosome 13 (position 2180837)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAAGTGATAYATTGTCTTGGCATGATAATAGCTTTTCTGTGTAATTGC[A/T]GATCTCAGGGTCASAGGATGGTTTCTGCTGGACGACTACATTCCCACCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Glaucoma: Genome-wide association study of normal tension glaucoma: common variants in SRBD1 and ELOVL5 contribute to disease susceptibility. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/eup04oyx