olfcg9

Ensembl ID:
ENSDARG00000004975
ZFIN ID:
ZDB-GENE-081029-6
Description:
Novel odorant receptor [Source:UniProtKB/TrEMBL;Acc:B8JIF3]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16402 Nonsense Available for shipment Available now
sa2754 Nonsense F2 line generated During 2016

Mutation Details

Allele Name:
sa16402
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067575 Nonsense 712 848 8 8
ENSDART00000145023 Nonsense 710 849 6 6
Genomic Location (Zv9):
Chromosome 14 (position 17585541)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 32697806
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAGTGTWCTTGCTTTTACATTTATACAAGTTTTAATCTGTGTGTTATG[G/A]CTATCAATATCTCCACCATTTCCCCACAAAAATATGAAATATTATGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2754
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067575 Nonsense 775 848 8 8
ENSDART00000145023 Nonsense 773 849 6 6
Genomic Location (Zv9):
Chromosome 14 (position 17585354)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 32697619
KASP Assay ID:
554-2945.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATTCTGGCTTTTCTGGCTAGGACACTTCCTGATAATTTCAATGAGGCC[A/T]AATTCATCACATTCAGTATGCTTATATTTTGTGCTGTATGGATCACTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link