olfcg9

Ensembl ID:
ENSDARG00000004975
ZFIN ID:
ZDB-GENE-081029-6
Description:
Novel odorant receptor [Source:UniProtKB/TrEMBL;Acc:B8JIF3]
Mouse Orthologues:
AC139131.1, AC161211.1, AC161211.2, Vmn2r54
Mouse Descriptions:
vomeronasal 2, receptor 53 [Source:RefSeq peptide;Acc:NP_001098114]
vomeronasal 2, receptor 54 Gene [Source:MGI Symbol;Acc:MGI:3704110]
vomeronasal 2, receptor 55 [Source:RefSeq peptide;Acc:NP_001098115]
vomeronasal receptor Vmn2r56 [Source:RefSeq peptide;Acc:NP_001098118]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4553 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16402 Nonsense Available for shipment Available now
sa2754 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa4553
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067575 Essential Splice Site 547 848 7 8
ENSDART00000145023 Essential Splice Site 545 849 5 6
Genomic Location:
Chromosome 14 (position 17586197)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTTATGACTGTATTCCATGTGCAGATGGAGAAATCAGTAACGACACAG[G/A]TAATACTCAGTATTTCTCACAGTTCCAAAGAAATCTGTTTAGTTGCTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16402
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067575 Nonsense 712 848 8 8
ENSDART00000145023 Nonsense 710 849 6 6
Genomic Location:
Chromosome 14 (position 17585541)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAGTGTWCTTGCTTTTACATTTATACAAGTTTTAATCTGTGTGTTATG[G/A]CTATCAATATCTCCACCATTTCCCCACAAAAATATGAAATATTATGAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2754
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000067575 Nonsense 775 848 8 8
ENSDART00000145023 Nonsense 773 849 6 6
Genomic Location:
Chromosome 14 (position 17585354)
KASP Assay ID:
554-2945.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATTCTGGCTTTTCTGGCTAGGACACTTCCTGATAATTTCAATGAGGCC[A/T]AATTCATCACATTCAGTATGCTTATATTTTGTGCTGTATGGATCACTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1vrex99y