bmp5

Ensembl ID:
ENSDARG00000004965
ZFIN ID:
ZDB-GENE-040426-1413
Description:
bone morphogenetic protein 5 [Source:RefSeq peptide;Acc:NP_957345]
Human Orthologue:
BMP5
Human Description:
bone morphogenetic protein 5 [Source:HGNC Symbol;Acc:1072]
Mouse Orthologue:
Bmp5
Mouse Description:
bone morphogenetic protein 5 Gene [Source:MGI Symbol;Acc:MGI:88181]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39497 Nonsense Mutation detected in F1 DNA During 2017
sa30324 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39497
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019239 Nonsense 108 446 1 12
Genomic Location (Zv9):
Chromosome Zv9_scaffold3454 (position 27304)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1742010
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCTCGCGGGGAAAGTGCGTAAAAGCGCGCCCGGAGCTCCGCACGGATA[T/A]TCGCGCGCGCCACCGCGTGTTCCGCAGCCGCAACACTCCCGCGCCGCGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30324
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019239 Nonsense 312 446 9 12
Genomic Location (Zv9):
Chromosome Zv9_scaffold3454 (position 46806)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 1768309
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCAAAGCCAGCGAGGTTTTGCTTCGTTCTGTGAGAGCCACGGGAAGC[A/T]AGAAGAAGAGCCACAACAGAAACAAAAGCAAAACACAAGCGAAATCAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link