rsad2

Ensembl ID:
ENSDARG00000004952
ZFIN ID:
ZDB-GENE-050913-129
Description:
Radical S-adenosyl methionine domain-containing protein 2 [Source:UniProtKB/Swiss-Prot;Acc:Q5RH95]
Human Orthologue:
RSAD2
Human Description:
radical S-adenosyl methionine domain containing 2 [Source:HGNC Symbol;Acc:30908]
Mouse Orthologue:
Rsad2
Mouse Description:
radical S-adenosyl methionine domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1929628]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13259 Nonsense Available for shipment Available now
sa4722 Nonsense Mutation detected in F1 DNA During 2014
sa19183 Nonsense Mutation detected in F1 DNA During 2014
sa13885 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13259
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019617 Nonsense 43 359 1 6
Genomic Location:
Chromosome 17 (position 35528317)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGCGCTGTTGAGATGGCTCTCCATGCAGGTTTCTGGCGCACATGTGCAA[C/T]AAACTCCTGCTAGAAAGATCAGCCGCCCAGAGAGTCGCAMCAGTAAACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4722
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019617 Nonsense 64 359 1 6
Genomic Location:
Chromosome 17 (position 35528254)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAGATCAGCCGCCCAGAGAGTCGCACCAGTAAACAGAAAGAGGGATCC[A/T]GAGCTCCGTTCACAACTCCAAGCAGTGTAAACTACCATTTCACCCGGCAR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19183
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019617 Nonsense 105 359 1 6
Genomic Location:
Chromosome 17 (position 35528131)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCCACACCGCGAAGACTTCTTTCGTCTTGCCTATTGAAGAAGCAAAG[C/T]GAGGCTTAAGACTGCTGAAAGAAGCAGGTAAACAACTTGTCTCTTAAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13885
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019617 Essential Splice Site 168 359 2 6
Genomic Location:
Chromosome 17 (position 35527517)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTGTTAGTAACGGCAGTCTGATCAGAGAAAGCTGGTTCCAGAAATACGG[T/A]AAGAATCTTTCATGGCCAGCAGAGGGCGGCAGAAGTTACTTGCAAACTTY
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/imurekc7