mtdhb

Ensembl ID:
ENSDARG00000004939
ZFIN ID:
ZDB-GENE-090929-2
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:B1H1H8]
Human Orthologue:
MTDH
Human Description:
metadherin [Source:HGNC Symbol;Acc:29608]
Mouse Orthologue:
Mtdh
Mouse Description:
metadherin Gene [Source:MGI Symbol;Acc:MGI:1914404]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa28728 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28728
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015170 Essential Splice Site 143 525 3 13
ENSDART00000075937 Essential Splice Site 143 414 3 9
ENSDART00000125369   None 504 None 14
Genomic Location (Zv9):
Chromosome 16 (position 44489983)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41770491
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGCAAAAATGTAAATGGTTATTCATTCATACTGATTCCTTTTGACTGT[A/G]GGGAAAGAAGAATAAGAAAAAGACAAAAGCTTCTGCAAAAGAGAAAAAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Migraine: Genome-wide association study of migraine implicates a common susceptibility variant on 8q22.1. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link