kal1b

Ensembl ID:
ENSDARG00000004932
ZFIN ID:
ZDB-GENE-000201-13
Description:
Kallmann syndrome 1b sequence [Source:RefSeq peptide;Acc:NP_571454]
Human Orthologue:
KAL1
Human Description:
Kallmann syndrome 1 sequence [Source:HGNC Symbol;Acc:6211]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24225 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24225
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003736 Essential Splice Site 530 648 11 14
ENSDART00000144318 Essential Splice Site 515 633 11 15
Genomic Location (Zv9):
Chromosome 22 (position 41951103)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38919096
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTATCGCTAATGGGGAGACGGAAAAAACCCGCTGCCTGCGCCAGAGAGGG[T/C]AAGATGACATCTAGCACATCCAGACAGCTGTATTGAGATCTAAATCCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link