lmo7a

Ensembl ID:
ENSDARG00000004930
ZFIN ID:
ZDB-GENE-030219-74
Description:
LIM domain only protein 7 [Source:RefSeq peptide;Acc:NP_001121703]
Human Orthologue:
LMO7
Human Description:
LIM domain 7 [Source:HGNC Symbol;Acc:6646]
Mouse Orthologue:
Lmo7
Mouse Description:
LIM domain only 7 Gene [Source:MGI Symbol;Acc:MGI:1353586]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13371 Nonsense Available for shipment Available now
sa2536 Essential Splice Site Mutation detected in F1 DNA During 2014
sa25424 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21468 Nonsense Mutation detected in F1 DNA During 2014
sa17775 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13371
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009920 Nonsense 142 1826 6 33
ENSDART00000090782 None None 270 None 7
ENSDART00000134084 None None 46 6 6
ENSDART00000134768 None None 351 None 8
ENSDART00000144843 None None 221 None 6
ENSDART00000145576 None None 252 None 7

The following transcripts of ENSDARG00000004930 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 22971658)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGAAAGGCACATGCTGATCCATTTTATAATGGACCTTACCTAAAACTG[A/T]AGGCTTTCGAGGGATTACTTGGCACCACACTATATAAGGTAAGATATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2536
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009920 Essential Splice Site 300 1826 8 33
ENSDART00000090782 None None 270 None 7
ENSDART00000134084 None None 46 None 6
ENSDART00000134768 None None 351 None 8
ENSDART00000144843 Essential Splice Site 98 221 2 6
ENSDART00000145576 None None 252 None 7

The following transcripts of ENSDARG00000004930 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 22966665)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGCTGGGCAAGCCCTATGTTCACAGAAGATGACGGCACTTTCACTAGG[T/C]ACAGTAATGCAAATCTGCACTTCAGAGATTTAAGGGGGCATTTGTTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25424
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009920 Essential Splice Site 785 1826 12 33
ENSDART00000090782 None None 270 None 7
ENSDART00000134084 None None 46 None 6
ENSDART00000134768 None None 351 None 8
ENSDART00000144843 None None 221 None 6
ENSDART00000145576 None None 252 None 7

The following transcripts of ENSDARG00000004930 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 22960189)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGAGAGGCCAGTCGAGTGCGTTACCGGAAGAGGCTGATGGTGGAGAG[G/A]TTAGGTTTCTGAGCCTGCAGAGATGCCTGTGTGTGCTTGTCATCGTGAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21468
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009920 Nonsense 887 1826 16 33
ENSDART00000090782 None None 270 None 7
ENSDART00000134084 None None 46 None 6
ENSDART00000134768 None None 351 None 8
ENSDART00000144843 Nonsense 200 221 6 6
ENSDART00000145576 None None 252 None 7

The following transcripts of ENSDARG00000004930 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 22952827)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTTGCCTCCCTCCCTCGCTCCTTCCCCTTTTCAGAGAGAGCAGAGGG[C/T]AAAGCAACTTAAGGGACAGCTTTAACTCCATCGTTGATGATGTCTTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17775
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009920 Nonsense 1289 1826 20 33
ENSDART00000090782 Nonsense 205 270 5 7
ENSDART00000134084 None None 46 None 6
ENSDART00000134768 None None 351 None 8
ENSDART00000144843 None None 221 None 6
ENSDART00000145576 None None 252 None 7

The following transcripts of ENSDARG00000004930 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 22947572)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACCATCAATCTGACCAGTCTGGATCCTCTAGGTCCCTCCGAGCCATA[T/A]CACACCACCAGCCTGGACTTCACATCCCAACAATCCAAGGACSCCGTTGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Type 1 diabetes: A genome-wide meta-analysis of six type 1 diabetes cohorts identifies multiple associated loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r8z0be6r