immp2l

Ensembl ID:
ENSDARG00000004925
ZFIN ID:
ZDB-GENE-040808-9
Description:
Mitochondrial inner membrane protease subunit 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6AZD4]
Human Orthologue:
IMMP2L
Human Description:
IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) [Source:HGNC Symbol;Acc:14598]
Mouse Orthologue:
Immp2l
Mouse Description:
IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:213

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17208 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17208
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010706 Nonsense 156 183 6 6
ENSDART00000073667 Nonsense 83 110 4 4
ENSDART00000141481 Nonsense 157 184 5 5
Genomic Location:
Chromosome 25 (position 21968958)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTTGTTCACGGTCGGGCGTCTCACATCATCTGGCCACCCAGTCGGTGG[C/T]AGCGAATYGAGCCGTCTGTCCCTYCAGACAGAAGACCACTGTTRAACTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qfskd6e3