Q568T9_DANRE

Ensembl ID:
ENSDARG00000004917
Description:
LOC553360 protein [Source:UniProtKB/TrEMBL;Acc:Q568T9]
Human Orthologue:
PCIF1
Human Description:
PDX1 C-terminal inhibiting factor 1 [Source:HGNC Symbol;Acc:16200]
Mouse Orthologue:
Pcif1
Mouse Description:
PDX1 C-terminal inhibiting factor 1 Gene [Source:MGI Symbol;Acc:MGI:2443858]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40806 Nonsense Mutation detected in F1 DNA During 2017
sa2316 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa40806
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009197 Nonsense 162 721 4 16
ENSDART00000051904 Nonsense 162 287 5 8
Genomic Location (Zv9):
Chromosome 6 (position 55625914)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 55335882
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGTACACCAGGAGTAAAACCTTGGGTTAACACCACCACAGATGAGAAA[C/T]AAGGCCAGGCCAGTACGCCTGCACCTGCACCGTACCGGCCCTCTGTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2316
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009197 Nonsense 249 721 6 16
ENSDART00000051904 Nonsense 249 287 7 8
Genomic Location (Zv9):
Chromosome 6 (position 55629955)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 55331841
KASP Assay ID:
554-3204.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCACGGGAATCCTTCAACCGCTGGCTTCTGGAGAGGAAAGTAGTGGAT[A/T]AAGGTCTGGATCCTCTCCTGCCCAGTGAATGTGACCCAGTCATCTCTCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link