cat

Ensembl ID:
ENSDARG00000004909
ZFIN ID:
ZDB-GENE-000210-20
Description:
Catalase [Source:UniProtKB/Swiss-Prot;Acc:Q9PT92]
Human Orthologue:
CAT
Human Description:
catalase [Source:HGNC Symbol;Acc:1516]
Mouse Orthologue:
Cat
Mouse Description:
catalase Gene [Source:MGI Symbol;Acc:MGI:88271]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13124 Essential Splice Site Available for shipment Available now
sa16024 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13124
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007781 None None 526 None 13
ENSDART00000123592 Essential Splice Site 350 526 9 15
Genomic Location:
Chromosome 25 (position 7805816)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCATTGTCTAATGAGTAATTNAGAAGAATGACTAAATACTGCAATTACT[C/T]AATTCTTTGCTGCAGGGGCGTCTTTTCTCCTACCCAGACACACATCGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16024
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007781 Nonsense 372 526 9 13
ENSDART00000123592 Nonsense 372 526 11 15
Genomic Location:
Chromosome 25 (position 7805743)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCTCCTACCCAGACAMACATCGCCATCGACTCGGAGCTAATTACCTC[C/T]AACTACCAGTCAACTGCCCGTACCGCACCCGTGTGGCAAACTATCAGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ixdy8et5