cat

Ensembl ID:
ENSDARG00000004909
ZFIN ID:
ZDB-GENE-000210-20
Description:
Catalase [Source:UniProtKB/Swiss-Prot;Acc:Q9PT92]
Human Orthologue:
CAT
Human Description:
catalase [Source:HGNC Symbol;Acc:1516]
Mouse Orthologue:
Cat
Mouse Description:
catalase Gene [Source:MGI Symbol;Acc:MGI:88271]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31106 Nonsense Mutation detected in F1 DNA During 2015
sa13124 Essential Splice Site Available for shipment Available now
sa16024 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31106
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007781 Nonsense 233 526 6 13
ENSDART00000123592 Nonsense 233 526 6 15
Genomic Location:
Chromosome 25 (position 7807318)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCGCACACCTTTAAACTGGTCAATGCTCAGGGCCAGCCGGTGTACTGC[A/T]AGTTCCACTACAAGGTACGTAGTTTGTGAGTGTCCACAGAAGCGTTTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13124
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007781   None 526 None 13
ENSDART00000123592 Essential Splice Site 350 526 9 15
Genomic Location:
Chromosome 25 (position 7805816)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCATTGTCTAATGAGTAATTNAGAAGAATGACTAAATACTGCAATTACT[C/T]AATTCTTTGCTGCAGGGGCGTCTTTTCTCCTACCCAGACACACATCGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16024
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007781 Nonsense 372 526 9 13
ENSDART00000123592 Nonsense 372 526 11 15
Genomic Location:
Chromosome 25 (position 7805743)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTCTCCTACCCAGACAMACATCGCCATCGACTCGGAGCTAATTACCTC[C/T]AACTACCAGTCAACTGCCCGTACCGCACCCGTGTGGCAAACTATCAGAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ixdy8et5